Review



plpcx empty vector  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    TaKaRa plpcx empty vector
    KEY RESOURCES TABLE
    Plpcx Empty Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plpcx+empty+vector/LRCX+Retroviral+Vector+Set/pmc08666140-78-0-4
    Average 95 stars, based on 26 article reviews
    plpcx empty vector - by Bioz Stars, 2026-10
    95/100 stars

    Images

    1) Product Images from "TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation"

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation

    Journal: Cell reports

    doi: 10.1016/j.celrep.2019.05.040

    KEY RESOURCES TABLE
    Figure Legend Snippet: KEY RESOURCES TABLE

    Techniques Used: Transduction, Recombinant, Modification, Protease Inhibitor, Staining, Transfection, Clone Assay, Construct, shRNA, Sequencing, Luciferase, Plasmid Preparation, Expressing, Software, Imaging, Western Blot

    Related Articles

    Plasmid Preparation:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Transduction:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Recombinant:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Modification:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Protease Inhibitor:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Staining:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Transfection:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Clone Assay:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Construct:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    shRNA:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Sequencing:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Luciferase:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Expressing:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Software:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Imaging:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na

    Western Blot:

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation
    Article Snippet: DNA , , . .. pLPCX Empty Vector , Clontech , Cat #519 631511. .. pLPCX human TRIM5 , Na



    Similar Products

    95
    TaKaRa plpcx empty vector
    KEY RESOURCES TABLE
    Plpcx Empty Vector, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plpcx+empty+vector/LRCX+Retroviral+Vector+Set/pmc08666140-78-0-4
    Average 95 stars, based on 1 article reviews
    plpcx empty vector - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    TaKaRa paper tgccaagcatgcctcactgcaa recombinant dna plpcx empty vector clontech
    KEY RESOURCES TABLE
    Paper Tgccaagcatgcctcactgcaa Recombinant Dna Plpcx Empty Vector Clontech, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plpcx+empty+vector/LRCX+Retroviral+Vector+Set/pm31189110-196-54-61
    Average 95 stars, based on 1 article reviews
    paper tgccaagcatgcctcactgcaa recombinant dna plpcx empty vector clontech - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc plpcx empty vector
    KEY RESOURCES TABLE
    Plpcx Empty Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plpcx+empty+vector/pcDNA3%2E1-(empty)-TAG+(Plasmid+%23138209)/pmc07265331-259-10-13
    Average 95 stars, based on 1 article reviews
    plpcx empty vector - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results


    KEY RESOURCES TABLE

    Journal: Cell reports

    Article Title: TRIM5α Restricts Flavivirus Replication by Targeting the Viral Protease for Proteasomal Degradation

    doi: 10.1016/j.celrep.2019.05.040

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: pLPCX Empty Vector , Clontech , Cat #519 631511.

    Techniques: Transduction, Recombinant, Modification, Protease Inhibitor, Staining, Transfection, Clone Assay, Construct, shRNA, Sequencing, Luciferase, Plasmid Preparation, Expressing, Software, Imaging, Western Blot